
Laboratory Animal and Comparative Medicine ›› 2024, Vol. 44 ›› Issue (1): 31-41.DOI: 10.12300/j.issn.1674-5817.2023.118
• Animal Models of Human Diseases • Previous Articles Next Articles
Jianhua ZHENG, Yunzhi FA, Qiaoyan DONG, Yefeng QIU(
)(
), Jingqing CHEN(
)(
)
Received:2023-08-17
Revised:2023-11-18
Online:2024-02-25
Published:2024-02-25
Correspondence to:
Yefeng QIU, Jingqing CHEN
CLC Number:
Jianhua ZHENG,Yunzhi FA,Qiaoyan DONG,et al. Construction and Evaluation of a Mouse Model with Intestinal Injury by Acute Hypoxic Stress in Plateau[J]. Laboratory Animal and Comparative Medicine, 2024, 44(1): 31-41. DOI: 10.12300/j.issn.1674-5817.2023.118.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.slarc.org.cn/dwyx/EN/10.12300/j.issn.1674-5817.2023.118
基因 Gene | 正向引物 Forward primers(5ʹ→3ʹ) | 反向引物 Reverse primers(5ʹ→3ʹ) |
|---|---|---|
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| TNF-α | CCTGTAGCCCACGTCGTAG | GGGAGTAGACAAGGTACAACCC |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| MCP-1 | TAAAAACCTGGATCGGAACCAAA | GCATTAGCTTCAGATTTACGGGT |
| IL-10 | AGCCTTATCGGAAATGATCCAGT | GGCCTTGTAGACACCTTGGT |
Table 1 Sequence list of primers used in real-time fluorescent quantitative PCR
基因 Gene | 正向引物 Forward primers(5ʹ→3ʹ) | 反向引物 Reverse primers(5ʹ→3ʹ) |
|---|---|---|
| β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| TNF-α | CCTGTAGCCCACGTCGTAG | GGGAGTAGACAAGGTACAACCC |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| MCP-1 | TAAAAACCTGGATCGGAACCAAA | GCATTAGCTTCAGATTTACGGGT |
| IL-10 | AGCCTTATCGGAAATGATCCAGT | GGCCTTGTAGACACCTTGGT |
Figure 1 Effects of hypoxic stress on body weight changes and morphology of the mucosa of the colon and duodenum in mice
Figure 2 Effects of hypoxic stress on the expression of the tight junction protein in mouse duodenal and colonic tissues as detected by Western blotting and immunohistochemistry
Figure 3 Effects of hypoxic stress on the expression of inflammatory cytokines in mouse duodenal and colonic tissues detected by real-time fluorescence quantitative PCR
Figure 4 Effects of hypoxic stress on apoptosis of mice intestinal epithelial cells detected by TUNEL staining method
Figure 5 Effects of hypoxic stress on the expression of intestinal apoptosis-related proteins in mouse colon detected by Western blotting and immunohistochemistry
| 1 | WANG F, ZHANG H, XU T, et al. Acute exposure to simulated high-altitude hypoxia alters gut microbiota in mice[J]. Arch Microbiol, 2022, 204(7):412. DOI: 10.1007/s00203-022-03031-4 . |
| 2 | NUSS R. Medical conditions and high-altitude travel[J]. N Engl J Med, 2022, 386(19):1866-1867. DOI: 10.1056/NEJMc 2203182 . |
| 3 | 王珍, 周亚洲, 王立坤, 等. 持续低氧条件下大鼠肠道微生物变化及其与心肌损伤的关联研究[J]. 微生物学报, 2023, 63(8):3054-3067. DOI: 10.13343/j.cnki.wsxb.20220862 . |
| WANG Z, ZHOU Y Z, WANG L K, et al. Alterations in gut microbiota and their associations with cardiac injury in rats after exposure to continuous normobaric hypoxia[J]. Acta Microbiol Sin, 2023, 63(8):3054-3067. DOI: 10.13343/j.cnki.wsxb.20220862 . | |
| 4 | KHANNA K, MISHRA K P, GANJU L, et al. High-Altitude-Induced alterations in Gut-Immune Axis: a review[J]. Int Rev Immunol, 2018, 37(2):119-126. DOI: 10.1080/08830185. 2017. 1407763 . |
| 5 | FRUEHAUF H, VAVRICKA S R, LUTZ T A, et al. Evaluation of acute mountain sickness by unsedated transnasal esophagogastroduodenoscopy at high altitude[J]. Clin Gastroenterol Hepatol, 2020, 18(10):2218-2225.e2. DOI: 10.1016/j.cgh.2019.11.036 . |
| 6 | HAMAD N, TRAVIS S P L. Weight loss at high altitude: pathophysiology and practical implications[J]. Eur J Gastroenterol Hepatol, 2006, 18(1):5-10. DOI: 10.1097/00042737-200601000-00002 . |
| 7 | LUO H, ZHOU D J, CHEN Z, et al. Establishment and evaluation of an experimental rat model for high-altitude intestinal barrier injury[J]. Exp Ther Med, 2017, 13(2):475-482. DOI: 10.3892/etm.2016.4012 . |
| 8 | MEIER D, COLLET T H, LOCATELLI I, et al. Does this patient have acute mountain sickness?[J]. JAMA, 2017, 318(18):1810. DOI: 10.1001/jama.2017.16192 . |
| 9 | MCKENNA Z J, GORINI PEREIRA F, GILLUM T L, et al. High-altitude exposures and intestinal barrier dysfunction[J]. Am J Physiol Regul Integr Comp Physiol, 2022, 322(3): R192-R203. DOI: 10.1152/ajpregu.00270.2021 . |
| 10 | WU T Y, DING S Q, LIU J L, et al. High-altitude gastrointestinal bleeding: an observation in Qinghai-Tibetan railroad construction workers on Mountain Tanggula[J]. World J Gastroenterol, 2007, 13(5):774-780. DOI: 10.3748/wjg.v13.i5.774 . |
| 11 | BISCHOFF S C, BARBARA G, BUURMAN W, et al. Intestinal permeability: a new target for disease prevention and therapy[J]. BMC Gastroenterol, 2014, 14:189. DOI: 10.1186/s12876-014-0189-7 . |
| 12 | KÖNIG J, WELLS J, CANI P D, et al. Human intestinal barrier function in health and disease[J]. Clin Transl Gastroenterol, 2016, 7(10): e196. DOI: 10.1038/ctg.2016.54 . |
| 13 | LOSHBAUGH J E, LOEPPKY J A, GREENE E R. Effects of acute hypobaric hypoxia on resting and postprandial superior mesenteric artery blood flow[J]. High Alt Med Biol, 2006, 7(1):47-53. DOI: 10.1089/ham.2006.7.47 . |
| 14 | MUSCH M W, CLARKE L L, MAMAH D, et al. T cell activation causes diarrhea by increasing intestinal permeability and inhibiting epithelial Na+/K+-ATPase[J]. J Clin Invest, 2002, 110(11):1739-1747. DOI: 10.1172/JCI15695 . |
| 15 | DINMORE A J, EDWARDS J S, MENZIES I S, et al. Intestinal carbohydrate absorption and permeability at high altitude (5, 730 m)[J]. J Appl Physiol, 1994, 76(5):1903-1907. DOI: 10.1152/jappl.1994.76.5.1903 . |
| 16 | LI Y Y, WANG Y C, SHI F, et al. Phospholipid metabolites of the gut microbiota promote hypoxia-induced intestinal injury via CD1d-dependent γδ T cells[J]. Gut Microbes, 2022, 14(1):2096994. DOI: 10.1080/19490976.2022.2096994 . |
| 17 | BASNYAT B, MURDOCH D R. High-altitude illness[J]. Lancet, 2003, 361(9373):1967-1974. DOI: 10.1016/S0140-6736(03)13591-X . |
| 18 | KARL J P, BERRYMAN C E, YOUNG A J, et al. Associations between the gut microbiota and host responses to high altitude[J]. Am J Physiol Gastrointest Liver Physiol, 2018, 315(6): G1003-G1015. DOI: 10.1152/ajpgi.00253.2018 . |
| 19 | FAN X X, LI S, WU Z L, et al. Glycine supplementation to breast-fed piglets attenuates post-weaning jejunal epithelial apoptosis: a functional role of CHOP signaling[J]. Amino Acids, 2019, 51(3):463-473. DOI: 10.1007/s00726-018-2681-9 . |
| 20 | PATANKAR J V, BUBECK M, ACERA M G, et al. Breaking bad: necroptosis in the pathogenesis of gastrointestinal diseases[J]. Front Immunol, 2023, 14:1203903. DOI: 10.3389/fimmu.2023.1203903 . |
| 21 | ZHANG W, JIAO L F, LIU R X, et al. The effect of exposure to high altitude and low oxygen on intestinal microbial communities in mice[J]. PLoS One, 2018, 13(9): e0203701. DOI: 10.1371/journal.pone.0203701 . |
| 22 | HUANG X, ZHOU Y Z, ZHAO T, et al. A method for establishing the high-altitude cerebral edema (HACE) model by acute hypobaric hypoxia in adult mice[J]. J Neurosci Methods, 2015, 245:178-181. DOI: 10.1016/j.jneumeth. 2015.02.004 . |
| 23 | ZHOU Y Z, HUANG X, ZHAO T, et al. Hypoxia augments LPS-induced inflammation and triggers high altitude cerebral edema in mice[J]. Brain Behav Immun, 2017, 64:266-275. DOI: 10.1016/j.bbi.2017.04.013 . |
| 24 | HILL G W, GILLUM T L, LEE B J, et al. Prolonged treadmill running in normobaric hypoxia causes gastrointestinal barrier permeability and elevates circulating levels of pro- and anti-inflammatory cytokines[J]. Appl Physiol Nutr Metab, 2020, 45(4):376-386. DOI: 10.1139/apnm-2019-0378 . |
| 25 | LI M, HAN T Y, ZHANG W J, et al. Simulated altitude exercise training damages small intestinal mucosa barrier in the rats[J]. J Exerc Rehabil, 2018, 14(3):341-348. DOI: 10.12965/jer. 1835128.064 . |
| 26 | SHIH D Q, TARGAN S R. Insights into IBD pathogenesis[J]. Curr Gastroenterol Rep, 2009, 11(6):473-480. DOI: 10.1007/s11894-009-0072-9 . |
| 27 | LIU L, LIANG L P, YANG C H, et al. Extracellular vesicles of Fusobacterium nucleatum compromise intestinal barrier through targeting RIPK1-mediated cell death pathway[J]. Gut Microbes, 2021, 13(1):1-20. DOI: 10.1080/19490976. 2021. 1902718 . |
| 28 | PATANKAR J V, BECKER C. Cell death in the gut epithelium and implications for chronic inflammation[J]. Nat Rev Gastroenterol Hepatol, 2020, 17(9):543-556. DOI: 10.1038/s41575-020-0326-4 . |
| 29 | LIU Y L, XU Q, WANG Y, et al. Necroptosis is active and contributes to intestinal injury in a piglet model with lipopolysaccharide challenge[J]. Cell Death Dis, 2021, 12(1):62. DOI: 10.1038/s41419-020-03365-1 . |
| 30 | STRÄTER J, WELLISCH I, RIEDL S, et al. CD95 (APO-1/Fas)-mediated apoptosis in colon epithelial cells: a possible role in ulcerative colitis[J]. Gastroenterology, 1997, 113(1):160-167. DOI: 10.1016/s0016-5085(97)70091-x . |
| 31 | OKUMURA R, TAKEDA K. Roles of intestinal epithelial cells in the maintenance of gut homeostasis[J]. Exp Mol Med, 2017, 49(5): e338. DOI: 10.1038/emm.2017.20 . |
| 32 | CHENG E H, KIRSCH D G, CLEM R J, et al. Conversion of bcl-2 to a bax-like death effector by caspases[J]. Science, 1997, 278(5345):1966-1968. DOI: 10.1126/science.278.5345.1966 . |
| 33 | MCKENNA Z J, BELLOVARY B N, DUCHARME J B, et al. Circulating markers of intestinal barrier injury and inflammation following exertion in hypobaric hypoxia[J]. Eur J Sport Sci, 2023, 23(10):2002-2010. DOI: 10.1080/17461391. 2023. 2203107 . |
| 34 | MCKENNA Z J, FENNEL Z J, BERKEMEIER Q N, et al. Exercise in hypobaric hypoxia increases markers of intestinal injury and symptoms of gastrointestinal distress[J]. Exp Physiol, 2022, 107(4):326-336. DOI: 10.1113/EP090266 . |
| [1] | QIANG Sujing, LI Dongting, XU Jinhua, CAI Li, WEI Siyu, ZOU Jialei, DING Yuqiang. Identification and Analysis of the Klebsiella pneumoniae Species Complex in Laboratory Rats and Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(4): 564-572. |
| [2] | DU Hongzhi, FAN Jin, WEI Xiaolu, WANG Lianmei, LIU Yan, CHEN Weiya, CHEN Tengfei, GAO Yunhang, SONG Ling, ZHANG Guangping, HOU Hongping. Multimodal Assessment of a Hypoxic Pulmonary Hypertension Mouse Model [J]. Laboratory Animal and Comparative Medicine, 2026, 46(4): 476-486. |
| [3] | WANG Juan, XU Jiahui, TIAN Yunyuan, ZHANG Mengmeng, LI Min, WANG Siwang, LI Yao. Comparison and Behavioral Observation of Two Female Mice Models of Ulcerative Colitis [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 332-343. |
| [4] | LI Longxue, WAN Chongfan, ZHANG Qi, LEI Ruting, WANG Xiaoyue, CHENG Leyan, LAI Qi, LIU Ronghua, LIU Xuan, XU Tielong. Molecular Mechanisms of Qingfei Paidu Decoction in the Prevention and Treatment of Acute Lung Injury in Mice Based on miRNA Sequencing [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 311-320. |
| [5] | AI Xiufeng, ZHANG Lizong, FANG Mingsun, LÜ Dongying, CHEN Chu, CAI Zhaowei, WANG Dejun. Analysis of Differences in the Intestinal Flora of Rats and Mice after Drinking Chlorinated Water Based on 16S rRNA Sequencing [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 437-445. |
| [6] | LIU Sai, FU Bin, LI Sidi, CHEN Zhida, ZHANG Yue, GUO Zhongkun, WANG Yongan, WANG Kezhou. Adra2a Regulates LPS-Induced Inflammation in Hepatocytes of Lbp-/- Mice via the MAPK Signaling Pathway [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 212-221. |
| [7] | ZHAO He, ZHANG Tao, LI Li, XIAO Yuzhou, AN Xuefang, ZHANG Fan. Enhancement Effect of Porcine Inhibin Polyclonal Antibody on Superovulation in C57BL/6J Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 271-278. |
| [8] | CUI Changwan, LU Yiping, YU Miao, WANG Shuang, WU Si, SUN Zhengrong. Inhibitory Effect of Solute Carrier Family 7 Member 5 Inhibitor JPH203 on Renal Fibrosis Induced by Unilateral Ureteral Obstruction in Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 205-211. |
| [9] | WU Xianwen, LIU Lili, CHEN Ye, XU Guoheng. Optimization of Cage-Changing Intervals and Wood Shavings Usage for Mice During the Growth Phase in Breeding Systems [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 251-260. |
| [10] | RONG Wenshuang, NIU Yuanfei, LIU Meiting, YANG Mengyuan, CUI Shuang, MA Lina, FU Yao, WANG Lianmei, CAO Junling. Influence of Antigen Type on the Establishment of an Induced Sjögren Syndrome Mouse Model [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 178-190. |
| [11] | XU Yingtao, WANG Mengmeng, LIN Ping, CHI Haitao, WANG Yi, BAI Ying. Exosomes Treat Ischemic Stroke by Regulation of Ferroptosis Through the NRF2/SLC7A11/GPX4 Pathway in Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 20-31. |
| [12] | YANG Lin, JIN Meng, WU Hanqing, LI Shun, ZHOU Xiaohui. Establishment and Preliminary Analysis of an AG6 Mouse Encephalopathy Model Induced by Vaccinia Virus Tiantan Strain Infection [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 3-10. |
| [13] | JIANG Haitao, YUAN Hantao, HUANG Wenting, YANG Rongrong, CHEN Xiaochun, YU Baoqing, LI Sibo. Regulation of Rat Intervertebral Disc Annulus Fibrosus Cell Proliferation and Apoptosis by Yaoshu Zhuyu Fang via miR-17-5P/MDM2/p53 Pathway [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 55-65. |
| [14] | LIU Chang, XIANG Xuesong, HE Huihuang, CHEN Xiaoqing, QIU Wenhong. Establishment and Evaluation of an Oxidative Stress Model of Atopic Dermatitis Induced by 2,4-dinitrofluorobenzene [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 46-54. |
| [15] | XU Bo, CHEN Tairen, FANG Qian, WU Ji. Research on Spatiotemporal Gene Expression Profiles and Repair Mechanisms of Spinal Cord Compression and Hemisection Spinal Cord Injury Mouse Models [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 32-45. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||