A Mouse Model of Polycystic Ovary Syndrome Established Through Subcutaneous Administration of Letrozole Sustained-Release Pellets and Hepatic Transcriptome Analysis

doi:10.12300/j.issn.1674-5817.2024.186

Abstract

Abstract:

Objective Prepubertal mice are administered subcutaneously with letrozole sustained-release pellets behind the neck and treated with a high-fat diet to establish a mouse model of polycystic ovary syndrome (PCOS). The liver transcriptomes of the model mice are compared with those of the placebo control mice to investigate the underlying mechanisms of liver involvement in the pathogenesis of PCOS. Methods A customized 2 mg dose of letrozole sustained-release pellets with a 40-day release period was used. The control placebo and letrozole pellets were implanted subcutaneously in the dorsal cervical region of 3-4-week-old C57BL/6J mice (8 mice per group) to establish the control group and letrozole-induced PCOS model group. Both groups were treated with a high-fat diet starting the day after administration. The modeling period lasted for 5 weeks, during which body weight and 24-hour food intake were monitored in each group every week. When samples were collected, liver weight was recorded. Pathological changes in ovarian and hepatic tissues were examined by hematoxylin-eosin (HE) staining, while hepatic lipid deposition was observed by Oil Red O staining. The extent of macrophage infiltration in the liver was evaluated via F4/80 immunohistochemical staining, and hepatic fibrosis levels were observed by Masson's trichrome staining. Transcriptomic sequencing was performed to analyze differentially expressed genes (DEGs) in liver tissues between the control and model groups, followed by enrichment analysis of significant DEGs. Quantitative real-time fluorescent quantitative PCR (qPCR) was subsequently used to validate the expression of significant DEGs in liver tissues of both groups. Results Compared with the control group, the model group which received subcutaneous letrozole sustained-release pellets combined with a high-fat diet exhibited significantly increased body weight (P<0.001), prominent polycystic ovarian morphology, and significantly decreased liver-to-body weight ratio (P<0.05). However, no significant changes were observed in absolute liver weight (P>0.05), hepatic histomorphology, or lipid deposition. Transcriptome sequencing identified 119 upregulated and 217 downregulated DEGs in the liver tissues of letrozole-treated mice, which were predominantly enriched in pathways related to cholesterol and steroid biosynthesis, steroid hormone metabolism, and inflammatory responses. qPCR validation demonstrated that mRNA expression of HSD3B2 and HMGCR was significantly upregulated in liver (P<0.01), while mRNA expression of IL4, CCL2 and COL1A1 was downregulated (P<0.05) in the model group compared with the control group. However, Masson's trichrome staining and F4/80 immunohistochemical analysis showed no significant changes in hepatic fibrosis or macrophage infiltration. Conclusion Subcutaneous administration of letrozole sustained-release pellets combined with a high-fat diet successfully establishes a mouse model of PCOS. The model mice exhibited significant changes in hepatic gene expression. Liver may contribute to PCOS pathogenesis through regulating cholesterol and steroid metabolism.

Key words: Letrozole, Polycystic ovary syndrome, Liver, Transcriptome sequencing, Mice

CLC Number:

Q95-33

XU Qiuyu,YAN Guofeng,FU Li,et al. A Mouse Model of Polycystic Ovary Syndrome Established Through Subcutaneous Administration of Letrozole Sustained-Release Pellets and Hepatic Transcriptome Analysis[J]. Laboratory Animal and Comparative Medicine, 2025, 45(2): 119-129. DOI: 10.12300/j.issn.1674-5817.2024.186.

Figures/Tables 6

References 29

1	Thessaloniki ESHRE/ASRM-Sponsored PCOS Consensus Workshop Group. Consensus on infertility treatment related to polycystic ovary syndrome[J]. Fertil Steril, 2008, 89(3):505-522. DOI:10.1016/j.fertnstert.2007.09.041 .
2	TEEDE H J, TAY C T, LAVEN J J E, et al. Recommendations from the 2023 international evidence-based guideline for the assessment and management of polycystic ovary syndrome[J]. J Clin Endocrinol Metab, 2023, 108(10):2447-2469. DOI:10.1210/clinem/dgad463 .
3	HOEGER K M, DOKRAS A, PILTONEN T. Update on PCOS: consequences, challenges, and guiding treatment[J]. J Clin Endocrinol Metab, 2021, 106(3): e1071-e1083. DOI:10.1210/clinem/dgaa839 .
4	KAUFFMAN A S, THACKRAY V G, RYAN G E, et al. A novel letrozole model recapitulates both the reproductive and metabolic phenotypes of polycystic ovary syndrome in female mice[J]. Biol Reprod, 2015, 93(3):69. DOI:10.1095/biolreprod.115.131631 .
5	BEGUM N, MANIPRIYA K, VEERESH B. Role of high-fat diet on letrozole-induced polycystic ovarian syndrome in rats[J]. Eur J Pharmacol, 2022, 917:174746. DOI:10.1016/j.ejphar. 2022. 174746 .
6	VASSILATOU E, VASSILIADI D A, SALAMBASIS K, et al. Increased prevalence of polycystic ovary syndrome in premenopausal women with nonalcoholic fatty liver disease[J]. Eur J Endocrinol, 2015, 173(6):739-747. DOI:10.1530/EJE-15-0567 .
7	PASCHOU S A, POLYZOS S A, ANAGNOSTIS P, et al. Nonalcoholic fatty liver disease in women with polycystic ovary syndrome[J]. Endocrine, 2020, 67(1):1-8. DOI:10.1007/s12020-019-02085-7 .
8	GIANNOULI A, STEFANAKI C, KOUSKOUTIS C, et al. Hepatokine profile in adolescents with polycystic ovary syndrome: a case-control study[J]. J Clin Med, 2023, 12(17):5744. DOI:10.3390/jcm12175744 .
9	LIU S, HU W J, HE Y R, et al. Serum Fetuin-a levels are increased and associated with insulin resistance in women with polycystic ovary syndrome[J]. BMC Endocr Disord, 2020, 20(1):67. DOI:10.1186/s12902-020-0538-1 .
10	BEDNARSKA S, FRYCZAK J, SIEJKA A. Serum β-Klotho concentrations are increased in women with polycystic ovary syndrome[J]. Cytokine, 2020, 134:155188. DOI:10.1016/j.cyto. 2020.155188 .
11	SHAH M Z UL HAQ, SHRIVASTAVA V K, MIR M A, et al. Role of diacerein on steroidogenesis and folliculogenesis related genes in ovary of letrozole-induced PCOS mice[J]. Chem Biol Interact, 2023, 377:110468. DOI:10.1016/j.cbi.2023.110468 .
12	VIRTANEN N, SAARELA U, KARPALE M, et al. Roxadustat alleviates metabolic traits in letrozole-induced PCOS mice[J]. Biochem Pharmacol, 2024, 229:116522. DOI:10.1016/j.bcp. 2024.116522 .
13	TREFTS E, GANNON M, WASSERMAN D H. The liver[J]. Curr Biol, 2017, 27(21): R1147-R1151. DOI:10.1016/j.cub.2017.09.019 .
14	LIU D, GAO X, PAN X F, et al. The hepato-ovarian axis: genetic evidence for a causal association between non-alcoholic fatty liver disease and polycystic ovary syndrome[J]. BMC Med, 2023, 21(1):62. DOI:10.1186/s12916-023-02775-0 .
15	WU Y X, YANG X Y, HAN B S, et al. Naringenin regulates gut microbiota and SIRT1/PGC-1ɑ signaling pathway in rats with letrozole-induced polycystic ovary syndrome[J]. Biomed Pharmacother, 2022, 153:113286. DOI:10.1016/j.biopha.2022. 113286 .
16	PIECZYŃSKA J M, PRUSZYŃSKA-OSZMAŁEK E, KOŁODZIEJSKI P A, et al. The role of a high-fat, high-fructose diet on letrozole-induced polycystic ovarian syndrome in prepubertal mice[J]. Nutrients, 2022, 14(12):2478. DOI:10.3390/nu14122478 .
17	RYU K J, PARK H, HAN Y I, et al. Effects of time-restricted feeding on letrozole-induced mouse model of polycystic ovary syndrome[J]. Sci Rep, 2023, 13(1):1943. DOI:10.1038/s41598-023-28260-5 .
18	LI Z, LIU Y, WANG Y, et al. Sodium oligomannate's amelioration of reproductive and metabolic phenotypes in a letrozole-induced PCOS-like mouse model depends on the gut microbiome[J]. Biol Reprod, 2024, 111(2):361-375. DOI:10.1093/biolre/ioae058 .
19	BANASZEWSKA B, DULEBA A J, SPACZYNSKI R Z, et al. Lipids in polycystic ovary syndrome: role of hyperinsulinemia and effects of metformin[J]. Am J Obstet Gynecol, 2006, 194(5):1266-1272. DOI:10.1016/j.ajog.2005.11.009 .
20	SALILEW-WONDIM D, WANG Q, TESFAYE D, et al. Polycystic ovarian syndrome is accompanied by repression of gene signatures associated with biosynthesis and metabolism of steroids, cholesterol and lipids[J]. J Ovarian Res, 2015, 8:24. DOI:10.1186/s13048-015-0151-5 .
21	LI H, YU X H, OU X, et al. Hepatic cholesterol transport and its role in non-alcoholic fatty liver disease and atherosclerosis[J]. Prog Lipid Res, 2021, 83:101109. DOI:10.1016/j.plipres. 2021.101109 .
22	TAKEI A, NAGASHIMA S, TAKEI S, et al. Myeloid HMG-CoA reductase determines adipose tissue inflammation, insulin resistance, and hepatic steatosis in diet-induced obese mice[J]. Diabetes, 2020, 69(2):158-164. DOI:10.2337/db19-0076 .
23	SIDDIQUI S, MATEEN S, AHMAD R, et al. A brief insight into the etiology, genetics, and immunology of polycystic ovarian syndrome (PCOS)[J]. J Assist Reprod Genet, 2022, 39(11):2439-2473. DOI:10.1007/s10815-022-02625-7 .
24	JOHNSON D E, O'KEEFE R A, GRANDIS J R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer[J]. Nat Rev Clin Oncol, 2018, 15(4):234-248. DOI:10.1038/nrclinonc.2018.8 .
25	ASHOUR D, REBS S, ARAMPATZI P, et al. An interferon gamma response signature links myocardial aging and immunosenescence[J]. Cardiovasc Res, 2023, 119(14):2458-2468. DOI:10.1093/cvr/cvad068 .
26	ESCOBAR-MORREALE H F, LUQUE-RAMÍREZ M, GONZÁLEZ F. Circulating inflammatory markers in polycystic ovary syndrome: a systematic review and metaanalysis[J]. Fertil Steril, 2011, 95(3):1048-1058.e1-2. DOI:10.1016/j.fertnstert. 2010.11.036 .
27	PHELAN N, O'CONNOR A, KYAW TUN T, et al. Leucocytosis in women with polycystic ovary syndrome (PCOS) is incompletely explained by obesity and insulin resistance[J]. Clin Endocrinol, 2013, 78(1):107-113. DOI:10.1111/j.1365-2265. 2012.04454.x .
28	EHSES J A, BÖNI-SCHNETZLER M, FAULENBACH M, et al. Macrophages, cytokines and beta-cell death in Type 2 diabetes[J]. Biochem Soc Trans, 2008, 36(Pt 3):340-342. DOI:10.1042/BST0360340 .
29	KRISHNAN A, MUTHUSAMI S, PERIYASAMY L, et al. Effect of DHT-induced hyperandrogenism on the pro-inflammatory cytokines in a rat model of polycystic ovary morphology[J]. Medicina, 2020, 56(3):100. DOI:10.3390/medicina56030100 .

引物名称 Primer name	引物序列 Sequence (5'→3')
36B4-F	AGATTCGGGATATGCTGTTGGC
36B4-R	TCGGGTCCTAGACCAGTGTTC
HSD3B2-F	GGTTTTTGGGGCAGAGGATCA
HSD3B2-R	GGTACTGGGTGTCAAGAATGTCT
HMGCR-F	CAAACATTGTCACCGCCATC
HMGCR-R	CCACCCACCGTTCCTATCTC
IL4-F	GGTCTCAACCCCCAGCTAGT
IL4-R	GCCGATGATCTCTCTCAAGTGAT
CCL2-F	TTAAAAACCTGGATCGGAACCAA
CCL2-R	GCATTAGCTTCAGATTTACGGGT
COL1A1-F	GCTCCTCTTAGGGGCCACT
COL1A1-R	CCACGTCTCACCATTGGGG

引物名称 Primer name	引物序列 Sequence (5'→3')
36B4-F	AGATTCGGGATATGCTGTTGGC
36B4-R	TCGGGTCCTAGACCAGTGTTC
HSD3B2-F	GGTTTTTGGGGCAGAGGATCA
HSD3B2-R	GGTACTGGGTGTCAAGAATGTCT
HMGCR-F	CAAACATTGTCACCGCCATC
HMGCR-R	CCACCCACCGTTCCTATCTC
IL4-F	GGTCTCAACCCCCAGCTAGT
IL4-R	GCCGATGATCTCTCTCAAGTGAT
CCL2-F	TTAAAAACCTGGATCGGAACCAA
CCL2-R	GCATTAGCTTCAGATTTACGGGT
COL1A1-F	GCTCCTCTTAGGGGCCACT
COL1A1-R	CCACGTCTCACCATTGGGG

[1]	WANG Juan, XU Jiahui, TIAN Yunyuan, ZHANG Mengmeng, LI Min, WANG Siwang, LI Yao. Comparison and Behavioral Observation of Two Female Mice Models of Ulcerative Colitis [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 332-343.
[2]	LI Longxue, WAN Chongfan, ZHANG Qi, LEI Ruting, WANG Xiaoyue, CHENG Leyan, LAI Qi, LIU Ronghua, LIU Xuan, XU Tielong. Molecular Mechanisms of Qingfei Paidu Decoction in the Prevention and Treatment of Acute Lung Injury in Mice Based on miRNA Sequencing [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 311-320.
[3]	AI Xiufeng, ZHANG Lizong, FANG Mingsun, LÜ Dongying, CHEN Chu, CAI Zhaowei, WANG Dejun. Analysis of Differences in the Intestinal Flora of Rats and Mice after Drinking Chlorinated Water Based on 16S rRNA Sequencing [J]. Laboratory Animal and Comparative Medicine, 2026, 46(3): 437-445.
[4]	RONG Wenshuang, NIU Yuanfei, LIU Meiting, YANG Mengyuan, CUI Shuang, MA Lina, FU Yao, WANG Lianmei, CAO Junling. Influence of Antigen Type on the Establishment of an Induced Sjögren Syndrome Mouse Model [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 178-190.
[5]	LIU Sai, FU Bin, LI Sidi, CHEN Zhida, ZHANG Yue, GUO Zhongkun, WANG Yongan, WANG Kezhou. Adra2a Regulates LPS-Induced Inflammation in Hepatocytes of Lbp^-/- Mice via the MAPK Signaling Pathway [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 212-221.
[6]	ZHAO He, ZHANG Tao, LI Li, XIAO Yuzhou, AN Xuefang, ZHANG Fan. Enhancement Effect of Porcine Inhibin Polyclonal Antibody on Superovulation in C57BL/6J Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 271-278.
[7]	CUI Changwan, LU Yiping, YU Miao, WANG Shuang, WU Si, SUN Zhengrong. Inhibitory Effect of Solute Carrier Family 7 Member 5 Inhibitor JPH203 on Renal Fibrosis Induced by Unilateral Ureteral Obstruction in Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 205-211.
[8]	WU Xianwen, LIU Lili, CHEN Ye, XU Guoheng. Optimization of Cage-Changing Intervals and Wood Shavings Usage for Mice During the Growth Phase in Breeding Systems [J]. Laboratory Animal and Comparative Medicine, 2026, 46(2): 251-260.
[9]	XU Bo, CHEN Tairen, FANG Qian, WU Ji. Research on Spatiotemporal Gene Expression Profiles and Repair Mechanisms of Spinal Cord Compression and Hemisection Spinal Cord Injury Mouse Models [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 32-45.
[10]	XU Yingtao, WANG Mengmeng, LIN Ping, CHI Haitao, WANG Yi, BAI Ying. Exosomes Treat Ischemic Stroke by Regulation of Ferroptosis Through the NRF2/SLC7A11/GPX4 Pathway in Mice [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 20-31.
[11]	YANG Lin, JIN Meng, WU Hanqing, LI Shun, ZHOU Xiaohui. Establishment and Preliminary Analysis of an AG6 Mouse Encephalopathy Model Induced by Vaccinia Virus Tiantan Strain Infection [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 3-10.
[12]	LIU Chang, XIANG Xuesong, HE Huihuang, CHEN Xiaoqing, QIU Wenhong. Establishment and Evaluation of an Oxidative Stress Model of Atopic Dermatitis Induced by 2,4-dinitrofluorobenzene [J]. Laboratory Animal and Comparative Medicine, 2026, 46(1): 46-54.
[13]	NIE Yongqiang, WANG Zhaoxia. Exploration and Practice of Building a One-Stop Service Platform for Gene-Edited Mice in University Animal Centers: A Case Study of Shanghai Jiao Tong University [J]. Laboratory Animal and Comparative Medicine, 2025, 45(5): 642-648.
[14]	WANG Chao, LI Shun, REN Xiaonan, YANG Hua, CHEN Lixiang, XU Chunhua, ZHOU Xiaohui. Aging Inhibits Memory Immune Response of CD8⁺ T Cells in Lungs of C57BL/6J Mice Against Influenza A (H1N1) Virus [J]. Laboratory Animal and Comparative Medicine, 2025, 45(5): 515-523.
[15]	LIU Yueqin, XUE Weiguo, WANG Shuyou, SHEN Yaohua, JIA Shuyong, WANG Guangjun, SONG Xiaojing. Observation of Digestive Tract Tissue Morphology in Mice Using Probe-Based Confocal Laser Endomicroscopy [J]. Laboratory Animal and Comparative Medicine, 2025, 45(4): 457-465.