Construction of Lipopolysaccaride Binding Protein Knockout Mice Using CRISPR/Cas9 Technology

doi:10.12300/j.issn.1674-5817.2022.002

Abstract

Abstract:

Objective To construct a stable hereditary lipopolysaccaride binding protein (Lbp) gene knockout mice by using clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) gene editing technology. Methods According to the sequence characteristics of Lbp gene in C57BL/6J mice, the target of sgRNA was designed, the 5'-end protein coding conserved sequence of Lbp gene was deleted and the shift mutation was introduced to inactivate LBP. The genome of F0, F1, F2, F3 generation mice was extracted; PCR was used to identify and sequence Lbp knockout; RT-PCR was used to verify Lbp gene transcription, and Western blotting was used to verify LBP protein expression in F2 generation. Results Five Lbp^+/- mice from F0 generation, three Lbp^+/- mice from F1 generation, four Lbp^-/- mice from F2 generation and thirty Lbp^-/- mice from F3 generation were obtained. RT-PCR showed that Lbp^-/- mice mRNA was 244 bp and the translation was stopped early by code-shifting mutation. Western blotting showed that LBP protein was not expressed in the liver of Lbp^-/- mice. Conclusion The Lbp gene knockout mice were successfully constructed by CRISPR/Cas9 technique, which will provide a basis for further study of the immune and physiological effects of LBP.

Key words: Lipopolysaccaride binding protein, CRISPR / cas9 technology, Stable inheritance, Gene knockout mice

CLC Number:

R-332

Sidi LI, Bin FU, Zhongkun GUO, Yingjie LIN, Zhenyu ZHANG, Chuanliang MI, Kezhou WANG. Construction of Lipopolysaccaride Binding Protein Knockout Mice Using CRISPR/Cas9 Technology[J]. Laboratory Animal and Comparative Medicine, 2022, 42(4): 294-300.

Figures/Tables 4

Figure 1 Lbp gene knockout diagramNote：Lbp， lipopolysaccaride binding protein gene. Below is the sequences of Lbp-L4 and Lbp-R1， and the sequence gray is protospacer adjacent motif （PAM）.

Table 1 Names and sequences of lipopolysaccaride binding protein (Lbp) gene-small guide RNA (gRNA) target

靶点名称

Target name

靶点序列（5’→3’）

Target sequence (5’→3’)

Lbp-L1

Lbp-L2

Lbp-L3

Lbp-L4

Lbp-L5

Lbp-R1

Lbp-R2

Lbp-R3

Lbp-R4

Lbp-R5

AGTTGCTCCCATCATCCCTGG

AGCCTGTGCTGTGACTGCCGG

ACCCCCTGACAACCCTGCAGG

TACACAGACCTAGTACTAAGG

TGGTTAGAAAACTGCCACAGG

GAACAAAGGCCAAAGTCATGG

GCCTTTGTTCCTTCTTCCTGG

GACAGACAGGTGTAACCCAGG

TGTAACCCAGGCCCCAGTGGG

AGAAAGAAACTCGGGACTCGG

Figure 2 Genotyping results of F0 and F2 lipopolysaccaride binding protein （Lbp） gene knockout miceNote： A， the results of genotype identification of F0 generation mice （using F and R primers， M is DL2000 marker， the arrow in the figure points to the mutation strip）； B， the sequencing peak map of F0 offspring No.3 female mice （base deletion 1 457 bp）； C， F2 mice genotype identification results （using F and R primers in left， using F and WT-R primers in right， M is DL2000 marker， the arrow in the figure points to the mutant band of homozygous mice）. KO： knockout； WT： wild type.

Figure 3 The expression of mRNA and protein in liver tissues of Lbp gene knockout mice detected by RT-PCR sequencing and Western blottingNote： A， mRNA sequencing peak mapping in Lbp knockout mice； B， the mRNA sequence of the Lbp gene knockout mice was aligned against the WT mice （the rightmost number is the base number corresponding to the last base in each line of Lbp mRNA sequence， and the second line is Lbp-/- termination）； C， western blotting of LBP expression in the liver of F2 generation mice. KO， knockout； WT， wild type.HE， heterozygote； HO， homozygote.

References 20

1	QIAO J, DONG C, WANG X P, et al. One-step production of bioactive human lipopolysaccharide binding protein from LPS-eliminated E. coli [J]. Protein Expr Purif, 2019, 157:17-20. DOI:10.1016/j.pep.2019.01.008 .
2	TSUKAMOTO H, TAKEUCHI S, KUBOTA K, et al. Lipopolysaccharide (LPS)-binding protein stimulates CD14-dependent Toll-like receptor 4 internalization and LPS-induced TBK₁-IKK ϵ -IRF₃ axis activation[J]. J Biol Chem, 2018, 293(26):10186-10201. DOI:10.1074/jbc.M117.796631 .
3	ALDAG J, PERSSON T, HARTMANN R K. 2'-fluoro-pyrimidine-modified RNA aptamers specific for lipopolysaccharide binding protein (LBP)[J]. Int J Mol Sci, 2018, 19(12):3883. DOI:10.3390/ijms19123883 .
4	YU Y, SONG G H. Lipopolysaccharide-binding protein and bactericidal/permeability-increasing protein in lipid metabolism and cardiovascular diseases[J]. Adv Exp Med Biol, 2020, 1276:27-35. DOI:10.1007/978-981-15-6082-8_3 .
5	STASI A, INTINI A, DIVELLA C, et al. Emerging role of lipopolysaccharide binding protein in Sepsis-induced acute kidney injury[J]. Nephrol Dial Transplant, 2017, 32(1):24-31. DOI:10.1093/ndt/gfw250 .
6	HEIZHATI M, LI N F, SHAO L, et al. Elevated serum concentrations of lipopolysaccharide binding protein might prolong sleep stage one in middle-aged hypertensive males[J]. Sleep Breath, 2017, 21(2):327-332. DOI:10.1007/s11325-016-1415-z .
7	PAL G D, SHAIKH M, FORSYTH C B, et al. Abnormal lipopolysaccharide binding protein as marker of gastrointestinal inflammation in Parkinson disease[J]. Front Neurosci, 2015, 9:306. DOI:10.3389/fnins.2015.00306 .
8	HE Z X, SONG Z C, MENG L L, et al. Lipopolysaccharide-induced transcriptional changes in LBP-deficient rat and its possible implications for liver dysregulation during Sepsis [J]. J Immunol Res, 2021, 2021:8356645. DOI:10.1155/2021/8356645 .
9	LI X J, LI L, SUN Y, et al. Comparison of the effect of recombinant bovine wild and mutant lipopolysaccharide-binding protein in lipopolysaccharide-challenged bovine mammary epithelial cells[J]. Cell Stress Chaperones, 2016, 21(3):439-452. DOI:10.1007/s12192-016-0671-y .
10	KOPP F, KUPSCH S, SCHROMM A B. Lipopolysaccharide-binding protein is bound and internalized by host cells and colocalizes with LPS in the cytoplasm: implications for a role of LBP in intracellular LPS-signaling[J]. Biochim Biophys Acta, 2016, 1863(4):660-672. DOI:10.1016/j.bbamcr.2016.01.015 .
11	SEETHALER B, BASRAI M, NEYRINCK A M, et al. Biomarkers for assessment of intestinal permeability in clinical practice[J]. Am J Physiol Gastrointest Liver Physiol, 2021, 321(1): G11-G17. DOI:10.1152/ajpgi.00113.2021 .
12	LAUGERETTE F, VORS C, ALLIGIER M, et al. Postprandial endotoxin transporters LBP and sCD14 differ in obese vs. overweight and normal weight men during fat-rich meal digestion[J]. Nutrients, 2020, 12(6):1820. DOI:10.3390/nu12061820 .
13	CHALUBINSKA-FENDLER J, FENDLER W, SPYCH M, et al. Lipopolysaccharide-binding protein is efficient in biodosimetry during radiotherapy of lung cancer[J]. Biomed Rep, 2016, 5(4):450-454. DOI:10.3892/br.2016.739 .
14	CIREGIA F, BAIWIR D, COBRAIVILLE G, et al. Glycosylation deficiency of lipopolysaccharide-binding protein and corticosteroid-binding globulin associated with activity and response to treatment for rheumatoid arthritis[J]. J Transl Med, 2020, 18(1):8. DOI:10.1186/s12967-019-02188-9 .
15	WON Y, YANG J I, PARK S, et al. Lipopolysaccharide binding protein and CD14, cofactors of toll-like receptors, are essential for low-grade inflammation–induced exacerbation of cartilage damage in mouse models of posttraumatic osteoarthritis[J]. Arthritis Rheumatol, 2021, 73(8):1451-1460. DOI:10.1002/art.41679 .
16	MOLINARO A, KOH A, WU H, et al. Hepatic expression of lipopolysaccharide-binding protein (Lbp) is induced by the gut microbiota through Myd88 and impairs glucose tolerance in mice independent of obesity[J]. Mol Metab, 2020, 37:100997. DOI:10.1016/j.molmet.2020.100997 .
17	宋子晨. LBP通过mTOR信号通路抑制脓毒症大鼠肝细胞线粒体损伤[D]. 合肥: 安徽医科大学, 2020.
	SONG Z C. LBP protected hepatic mitochondria from sepsis-induced damage via mTOR signaling pathway in rat sepsis model[D]. Hefei: Anhu University of Chinese Medicine, 2020.
18	WANG M, MA L J, YANG Y, et al. N-3 Polyunsaturated fatty acids for the management of alcoholic liver disease: a critical review[J]. Crit Rev Food Sci Nutr, 2019, 59(sup1): S116-S129. DOI:10.1080/10408398.2018.1544542 .
19	PERVIN M, KARIM M R, KURAMOCHI M, et al. Macrophage populations and expression of regulatory inflammatory factors in hepatic macrophage-depleted rat livers under lipopolysaccharide (LPS) treatment[J]. Toxicol Pathol, 2018, 46(5):540-552. DOI:10.1177/0192623318776898 .
20	MOTIANI K K, COLLADO M C, ESKELINEN J J, et al. Exercise training modulates gut microbiota profile and improves endotoxemia[J]. Med Sci Sports Exerc, 2020, 52(1):94-104. DOI:10.1249/MSS.0000000000002112 .

[1]	CHI Jun, GONG Hui, HE Yue-wei, WAN Ying-han, FEI Jian, KUANG Ying. Generation and Phenotyping Analysis of Lep Gene Knockout Mice [J]. Laboratory Animal and Comparative Medicine, 2017, 37(5): 344-351.
[2]	ZHANG Xiao-huan1,HU Yan1,Camile S Farah2,Robert B Ashman2. Murine Models of Candida Infection and Host Genetic Factors [J]. , 2008, 28(1): 57-61.